Chst10 antibody thermo

WebType Antibody Immunogen A synthetic peptide derived from the internal region of human CHST10 Conjugate Unconjugated Form Liquid Concentration 1mg/ml Purification … WebAntibody: Immunogen: CHST10 fusion protein Ag2627: Full Name: carbohydrate sulfotransferase 10: Calculated molecular weight: 356 aa, 42 kDa: Observed molecular …

Anti-CHST10 Rabbit Polyclonal Antibody VWR

WebBest Art Classes in Fawn Creek Township, KS - Elaine Wilson Art, Tallgrass Art Gallery, Bevs Ceramic Shed, MillieArt WebFawn Creek Township is a locality in Kansas. Fawn Creek Township is situated nearby to the village Dearing and the hamlet Jefferson. Map. Directions. Satellite. Photo Map. bit rate gcse https://orlandovillausa.com

anti-CHST10 antibody (Internal Region) Product No. ABIN6258961

WebThermo Fisher Scientific's CHST10 Antibody is a Rabbit Polyclonal antibody. This antibody has been shown to work in applications such as: Immunohistochemistry, … WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution; Synonyms: Anti-Carbohydrate sulfotransferase 10,Anti-HNK-1 sulfotransferase,Anti-HNK-1ST,Anti-HNK1ST,Anti-huHNK-1ST; find Sigma-Aldrich-HPA012884 MSDS, related peer … WebWe offer a wide range of validated CHST10 antibodies. Order online or by email, fax, or phone. ️ Low Prices ️ 100% Guarantee ️ FREE Shipping data input form power bi

Anti-CHST10 Antibodies Invitrogen

Category:CHST10 RABBIT MAB

Tags:Chst10 antibody thermo

Chst10 antibody thermo

CHST10 Antibody from Thermo Fisher Scientific - biocompare.com

WebBuy rabbit polyclonal antibody to CHST10 (A37117). Validated Applications: WB and IHC. Tested Reactivity: Human. ️ Low Prices ️ 100% Guarantee WebAnti-CHST10 Antibody Products from Thermo Fisher Scientific. Anti-CHST10 antibodies are offered by a number of suppliers. This target gene encodes the protein 'carbohydrate sulfotransferase 10' in humans and may also be known as HNK1ST, HNK-1ST, HNK-1 sulfotransferase, and huHNK-1ST. Structurally, the protein is reported to be 42.2 …

Chst10 antibody thermo

Did you know?

WebThere are currently no images for Carbohydrate Sulfotransferase 10/CHST10 Antibody (NBP2-97238IR). Every product we sell is backed by Novus' 100% Guarantee . If you … WebView Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 488] (NBP2-97238G). Validated Applications: IHC, IHC-P. Validated Species: Human.

WebImmunohistochemical analysis of paraffin-embedded human gliomas using 12013-1-AP (CHST10 antibody) at dilution of 1:50 (under 10x lens). View All Images (2) Save time and replace your secondary antibodies with our FlexAble Antibody Labeling Kits $389 / 150 μL Cat No. 12013-1-AP In stock. WebBest Cinema in Fawn Creek Township, KS - Dearing Drive-In Drng, Hollywood Theater- Movies 8, Sisu Beer, Regal Bartlesville Movies, Movies 6, B&B Theatres - Chanute Roxy …

WebCHST10 (HNK-1ST) protein expression summary. We use cookies to enhance the usability of our website. If you continue, we'll assume that you are happy to receive all cookies. ... Antibody specificity analysis with protein arrays. Predicted and matching interactions are shown in green. Antibody dilution: 1:3000: 1:500: ANTIGEN INFORMATION; WebAnti-CHST10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody; Synonyms: HNK-1ST; find Sigma-Aldrich-HPA051545 MSDS, related peer-reviewed papers, technical documents, similar products & more at Sigma-Aldrich

WebCHST10, Rabbit anti-Human, Polyclonal Antibody, Abnova™-Rabbit Polyclonal Antibody

WebFeb 2, 2013 · A Chst10 targeting vector was constructed as shown in Fig. 1. Homologously recombined ES clones were selected by Southern hybridization using a probe adjacent to the targeting vector. Probe DNA (about 450 bp) was amplified by PCR using the following primers: 5–12s, TGTAGTCAAGGCAGCAACCAAGCA, and 5–13a, … data input from home jobsWebCarbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR): Novus Biologicals View Rabbit Polyclonal anti-Carbohydrate Sulfotransferase 10/CHST10 Antibody [DyLight 680] (NBP2-97238FR). Validated Applications: IHC, IHC-P. Validated Species: Human. Skip to main content Support: 1-888-506-6887 Items in Cart (0) [X] … data input jobs sheffieldWebIHC-P analysis of human lung carcinoma tissue using GTX87551 CHST10 antibody. The picture on the right is blocked with the synthesized peptide. GTX87551 WB Image WB analysis of HUVEC cell lysates using … bitrate hesaplamaWebCHST10, Rabbit, Monoclonal Antibody, Abnova™-Rabbit monoclonal antibody raised against a human CHST10 peptide using ARM Technology. Fisher Scientific Fisher Healthcare data input graphing calculator onlineWebCHST10 Antibody (PA5-106630) in ICC/IF. Immunofluorescent analysis of CHST10 in HUVEC cell lysate. Samples were fixed with paraformaldehyde, permeabilized with 0.1% … bitrate for screen recordingbit rate hierarchyWebCompare Anti-CHST10 Immunohistochemistry Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more. bitrate hd